Arabidopsis thaliana cDNA Clone Homologous to the Genes Coding
for Cellulose Synthase

Robert J. Sims and Senthil Sankaralingam

BOT 380C Dr. K. Sathasivan

4/28/97

ABSTRACT

Cellulose is the primary component of plant cell walls. The only known enzyme to be unique to the cellulose synthetic pathway is cellulose synthase. We have isolated and partially sequenced a cDNA clone from Arabidopsis thaliana that contains regions of homology [82%] to the Gossypium hirsutum protein CelA-2. The CelA-2 protein has been shown to belong to a family of related proteins involved in cellulose synthesis, specifically, the protein cellulose synthase. Southern analysis, using the cDNA clone as a probe, showed that this A.thaliana gene is a member of a small gene family, consisting of 3 or 4 genes. mRNA transcription of this cDNA was found to be most prevalent in stem and flower tissue, sights of active cell division.

INTRODUCTION

Cellulose is the principle structural material in plants, comprising 80% of their dry weight. It has been estimated that cellulose accounts for over half the carbon in the biosphere; approximately 1015 kilograms of cellulose is estimated to be synthesized and degraded annually. The only enzyme known to be unique to the cellulose synthesis pathway is cellulose synthase. There has been a great deal of effort in order to characterize the enzyme(s) responsible for the synthesis of cellulose (1,4-B-D-glucan) in higher plants. Until recently, a catalytic subunit for the synthesis of cellulose had not been characterized in higher plants (3 and 9). Several genes and operons have been cloned from bacterial, including Acetobacter xylinum, Escherichia coli, and Agrobacterium tumefaciens, and plant species, including Gossypium hirsutum and Oryza sativa, which are involved in the synthesis of cellulose. It appears, via recent studies (3), that there are conserved motifs among common glycosyltransferases which use UDP-glucose or UDP-glucoseNAc as a substrate. It appears that each essential region to cellulose synthesis contains a conserved Asp residue; furthermore, an additional region contains a conserved QXXRW motif (10) common in related glycosyltransferases. The amino acid sequence of the A. thaliana cDNA we have isolated contains homologies to two of these essential regions, including the QXXRW motif. Due to these observations, it is possible that this cDNA may code for the catalytic subunit of cellulose synthase in A. thaliana. Further characterization by Southern blot confirms the identity of a small gene family of cellulose synthase proteins within A.thaliana. Additionally, the levels of gene expression are examined by Northern blot.

MATERIALS AND METHODS

Isolation of the cDNA clone, Subcloning, and Minipreparation.

An unidentified cDNA insert, contained within the plasmid pZL1, was obtained from the Arabidopsis Biotechnology Research Center. This plasmid was isolated from Escherichia coli using a modified alkaline-lysis method (1, 7). The isolated plasmid was subcloned into the pBluescript (Stratagene) phagemid after it was restriction cut with EcoRI and HindIII (Promega). The pBluescript, containing the cDNA insert, was then transformed into the E.coli host XL1-Blue using the CaCl2 method (11). The isolated plasmid was then purified with a Quiagen Miniprep Kit (8). Selected transformants were then amplified by PCR (5).

DNA Sequencing and Characterization.

The PCR product from above was sequenced using the Sanger dideoxy chain termination method (12) along with the Sequenase Version 2.0 DNA sequencing kit (14). The cDNA insert was also characterized by automated sequencing at the DNA Sequencing Center (UT Austin). Two primers, SP6 (ATTTAGGTGACACTATAG) and T7 (TAATACGACTCACTATAGGG), were used to sequence both strands. The insert sequences were analyzed (ORF, translation, hyrophilicity plots, secondary structure) using the Mac Vector software package; the sequence and amino acid comparisons were made on NCBI's Blast server.

Isolation of Genomic DNA and Southern Analysis from A. thaliana.

The genomic DNA was isolated from A.thaliana using standard protocols (2, 15, 13). The isolated genomic DNA was then digested using EcoRI, HindIII, and BamHI (Promega). The digested fragments were then run on an 0.7% agarose gel and transferred to a Zetaprobe nylon membrane (Biorad) via a Southern transfer (16). The membrane was hybridized using the cDNA insert as a probe, labeled with ý-P32 dATP by random priming (4).

Isolation of RNA and Northern Analysis from A. thaliana.

Total RNA was isolated from a variety of sources in A.thaliana, including whole plant, leaf, flower, and stem using standard protocols (11). In addition, total RNA was isolated from wounded plants at different time intervals (0, 1, 5, 8 hours) after wounding. The RNA was run on a formaldehyde-1.2% agarose gel and transferred to a Zetaprobe nylon membrane via a Northern Transfer (11). The RNA was hybridized using the same probe as above (Southern).

RESULTS

DNA Sequence Analysis.

The recombinant plasmid in pBluescript was found to be 4.6 kb; therefore, the insert is approximately 1.6 kb in length (pBluescript is 3.0 kb). The pZL1 plasmid is 5.9 kb in length, with the cDNA insert (CelA homolog); this can be seen in Figure 1. The deduced ORF for the cDNA insert sequence, along with the translated amino acid sequence found to be homologous to cellulose synthase, is given for the T7 (A) and SP6 (B) primers in Figure 2.

Protein Sequence Analysis.

Alignments between the cDNA insert amino acid sequence and three other related genes are given in Figure 3. The comparisons are with the G.hirsutum CelA-2, G.hirsutum CelA-1, and O.sativa CelA proteins. The homologies to the cellulose synthase catalytic subunits are prevalent.

Southern Analysis.

The Southern blot appears to contain several bands for each of the three distinct restricted samples. This would suggest a small gene family, possible 3 or 4 distinct members. The Southern blot is shown in Figure 4.

Northern Analysis.

The Northern blot suggests that the highest concentration of mRNA for the cDNA insert is present in stem and flower. The mRNA in leaves are expressed in much lower concentrations and undetectable in whole plant. It appears that after wounding, mRNA transcription of our cDNA insert is not as critical. Repair mechanisms most likely would dominate over cellular division, where cellulose synthesis would be needed. The Northern blot is shown in Figure 5. The major mRNA species is around 2.5 kb in length.

Hydrophilicity Analysis.

The Kyte-Doolittle hydrophilicity plots of the T7 and SP6 primed amino acids are shown in Figures 6A and 6B, respectively. A hypothetical orientation of the cotton celA1 protein in the plasma membrane is given in Figure 6C. The homologies for the cDNA insert to this cotton protein are given in Figure 6C.

Secondary Structure Analysis.

Proposed secondary structure for T7 and SP6 primed amino acid sequences are shown in Figures 7A and 7B, respectively. Figure 7A shows inconsistences, perhaps due to complex or infrequent secondary structure in the cytoplasmic region between regions B and C, in Figure 6C. Figure 7B shows possible alpha-helices, perhaps corresponding to the regions F and G, in Figure 6C.


Figure 1. Multi-cloning region in pZL1, where the cDNA insert (cel A) is inserted between EcoRI and HindIII. The T7 and SP6 primer were later used for sequencing.

Figure 2A. The ORF nucleotide sequence for the T7 primer. The translated sequence is the region of homology shown in figure 3.

Figure 2B. The ORF nucleotide sequence for the SP6 primer. The translated sequence is the region of homology shown in figure 3.

Figure 3. The regions marked U-3 and U-4 are predicted to be critical in substrate binding and catalysis. Important conserved homologies are in bold face; the stared regions indicate critical amino acids. Adopted Pear, et al (6).

Figure 4. This is a picture of a Southern blot done under low stringency conditions. The appearance of multiple bands under BamHI cut DNA suggests a small gene family (3 or 4 genes).

Figure 5. Northern blot indicating the varying expression of mRNA. The letters are as follows (left to right): T8 (8 hours after wounding), T5 (5 hours), T1 (1 hour), T0 (time 0), S (stem), F (flower), L (leaves), W (whole plant). The major mRNA species is around 2.5 kb in length.

Figure 6. The hydrophobic chart for (A) T7 and (B) SP6 primed amino acid sequences (Kyte-Doolittle). Fig. C shows a hypothetical orientation of the cotton celA1 protein in the plasma membrane. The T7 primer region corresponds to the cytoplasmic region between the transmembrane region B and C. The SP6 primer region corresponds to the regions E, F and G (C).


DISCUSSION

This Arabidopsis cDNA insert contains homologies to conserved subunits in plants and bacteria responsible for the synthesis of cellulose. These homologies suggest that this clone may have a critical role in the cell wall synthesis of Arabidopsis. There appears to be four conserved subdomains within this family of cellulose synthase genes. Within these subdomains, designated U-1 - U-4, there is a highly conserved Asp residue; in subdomain four, there is a highly conserved QXXRW motif (10). The cDNA insert does contain the U-3 and U-4 region; however, the U-1 and U-2 regions are not present. The size of the full length mRNA was found to be 2.5 kb, while our cDNA insert is around 1.6 kb. This suggests that our cDNA insert is not full length; the full length clone may reveal the U-1 and U-2 regions. Alternatively, these missing regions may not be a part of this gene product; the G. hirsutum CelA-2 protein does not contain the conserved U-1 region. The exact implications of this deleted region are not currently understood. Once the A.thaliana cDNA is fully cloned, further assays can be done to clarify this issue. The Southern blot analysis shows the existence of a small gene family of cellulose synthase genes, possibly 3 or 4. Other higher plants (cotton) have shown similar data (6). Perhaps several related proteins combine to form a multi-protein complex at the plasma membrane which catalyzes the formation of cellulose. The highest level of mRNA transcription of the cDNA insert occurs in the stem and flower. During the life cycle of a mature plant, these are the sites where transcription would be predicted to be the highest. The stem and flower are the sites of the highest cell division. Once this cDNA is cloned, further experiments can shed more light on the role of this cDNA in cellulose synthesis.

REFERENCES

1. Birnboim, H.C. 1983. A rapid alkaline extraction method for the isolation of plasmid DNA. Methods. Enzymol. 100:243-255.

2. Chung, K.H., S.S. Korban and D. E. Buetow. 1994. Construction of genomic DNA library using high-molecular weight DNA prepared from peach leaves. Plant Mol. Bio. Reporter 12:304-309.

3. Delmer, D.P. and Amor, Y. 1995. Cellulose biosynthesis. Plant Cell 7:987-1000.

4. Feinberg, A.P. and B. Vogelstein. 1983, 1984 Anal. Biochem. 132:6 and 137:266.

5. Innis, M.A., Gelfand, D.H., Sninsky, J.J., and White., T.J., 1990. PCR Protocols. A guide to methods and applications. Academic Press. pp. 3-13.

6. Pear, J. R., Kawagoe, Y., Schreckengost, W.E., Delmer, D.P., and David M. Stalker. 1996. Higher plants contain homologues of the bacterial celA genes encoding the catalytic subunit of cellulose synthase. Proc. Natl. Acad. Sci. U.S.A. 93:12637-12642.

7. Protocol modified by Drs. Paul Kreig and Doug Melton, Harvard University. Protocols and Applications Guide. 2nd Edition, Promega.

8. QIAprep Plasmid Handbook for Standard Plasmid Miniprep. 1995. QIAGEN, Chadsworth, CA.

9. Ross, P., Mayer, R. and M. Benziman. 1991. Cellulose biosynthesis and function in bacteria. Microbiol. Rev. 55:35-38.

10. Saxena, I.M., Kudlicka, K., Okuda, K. and Brown, R.M., Jr. 1994. Characterization of genes in the cellulose-synthesizing operon (acs operon) of Acetobacter xylinum: implications for cellulose crystallization. J. Bacteriol. 176: 5735-5752.

11. Sambrook, J., Fritsch, E.F. and Maniatis, T. 1989. Molecular Cloning - A Laboratory Manual. Cold Spring Harbour Press.

12. Sanger, F., S. Nicklen and A.R. Coulson. 1977. DNA Sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74:5463-5467.

13. Schuler, M.A. and R.E. Zelinski. 1989. Methods in Plant Molecular Biology.Academic Press, Inc., San Diego, pp. 71-73.

14. Sequenase Version 2.0 DNA sequencing kit. Step by Step Protocols. United States Biochemical, Cleaveland, OH. pp. 1-25.

15. Tai, T. and Tangsley, S. 1991. Plant Mol. Bio. Reporter 8:297-303.

16. Zetaprobe Blotting Membranes. 1992. Instruction manual. Bio-Rad Labs. Hercules, CA.